circad | circRNAs associated with diseases

Circular RNA ATXN7
Gene	ATXN7	Organism	Human
Genome Locus		Build	hg19
Disease	Non-small Cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	31186686
Experimental Method
Sample Type	Tissue and cell lines	Comparison	A total of 57 pairs of NSCLC tissues and adjacent normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCTAGGGACAGAATTGGACGA Reverse GCCCGCTCCGACATTCTT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Huang, Q, Wang, S, Li, X, Yang, F, Feng, C, Zhong, K, Qiu, M, Wang, J (2019). Circular RNA ATXN7 is upregulated in non-small cell lung cancer and promotes disease progression. Oncol Lett, 17, 6:4803-4810.